Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU050181

Sigma-Aldrich

MISSION® esiRNA

targeting human LRG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATCTCCTGTCAACCACCTGCCGAAATCCCCGGCTACCTGCCAGCCGACACCGTGCACCTGGCCGTGGAATTCTTCAACCTGACCCACCTGCCAGCCAACCTCCTCCAGGGCGCCTCTAAGCTCCAAGAATTGCACCTCTCCAGCAATGGGCTGGAAAGCCTCTCGCCCGAATTCCTGCGGCCAGTGCCGCAGCTGAGGGTGCTGGATCTAACCCGAAACGCCCTGACCGGGCTGCCCCCGGGCCTCTTCCAGGCCTCAGCCACCCTGGACACCCTGGTATTGAAAGAAAACCAGCTGGAGGTCCTGGAGGTCTCGTGGCTACACGGCCTGAAAGCTCTGGGGCATCTGGACCTGTCTGGGAACCGCCTCCGGAAACTGCCCCCCGGGCTGCTGGCCAACTTCACCCTCCTGCGCACCCTTGACCTTGGGGAGAACCAGTTGGAGACCTTGC

Numéro d'accès Ensembl | humain

ENSG00000171236

Numéro d'accès NCBI

NM_052972

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... LRG1(116844) , LRG1(116844)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lan Luan et al.
Experimental and therapeutic medicine, 21(4), 367-367 (2021-03-19)
Retinoblastoma (RB) is the most common primary intraocular cancer type that occurs during retinal development in childhood. Previous studies have reported that long non-coding RNAs (lncRNAs) are involved in the development of RB. Therefore, the aim of the present study
Yiyun Wang et al.
Cell death & disease, 8(3), e2715-e2715 (2017-03-31)
The incomplete understanding of aberrant neovascularization, which contributes to osteoarthritis suggests that additional modulators have yet to be identified. Our objective was to identify the role of Leucine-rich-alpha-2-glycoprotein1 (LRG1), a new regulator of pathogenic angiogenesis, in osteoarthritis progression and to
Qian Zhang et al.
OncoTargets and therapy, 11, 2745-2752 (2018-05-23)
Leucine-rich α-2-glycoprotein-1 (LRG1) is differentially expressed in many kinds of diseases including cancer, however, it has not been thoroughly studied yet. The objective of this study was to detect the expression and potential mechanism of LRG1 in colorectal cancer (CRC).
Masaaki Yamamoto et al.
Cancer science, 108(10), 2052-2060 (2017-07-27)
Gastric cancer is one of the most common malignant tumors. Although improvement in chemotherapy has been achieved, the clinical prognosis of advanced gastric cancer remains poor. Therefore, it is increasingly important to predict the prognosis and determine whether patients should
Gu Gong et al.
Journal of molecular neuroscience : MN, 54(1), 20-26 (2014-02-15)
Lipopolysaccharide (LPS) preconditioning is a powerful neuroprotective phenomenon by which an injurious stimulus renders the brain resistant to a subsequent damaging ischemic insult. The LPS response gene (Lrg) is a recently identified gene in human dental pulp cells treated with
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique