Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU049601

Sigma-Aldrich

MISSION® esiRNA

targeting human FA2H

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCTTCATGCTGGGGACATTCCTCTGGAGCCTCATCGAGTACCTCATCCACCGCTTCCTGTTCCACATGAAGCCCCCCAGCGACAGCTATTACCTCATCATGCTGCACTTCGTCATGCACGGCCAGCACCACAAGGCACCCTTCGACGGCTCCCGCCTGGTCTTCCCCCCTGTGCCAGCCTCCCTGGTGATCGGCGTCTTCTACTTGTGCATGCAGCTCATCCTGCCCGAGGCAGTAGGGGGCACTGTGTTTGCGGGGGGCCTCCTGGGCTACGTCCTCTATGACATGACCCATTACTACCTGCACTTTGGCTCGCCGCACAAGGGCTCCTACCTGTACAGCCTGAAGGCCCACCACGTCAAGCACCACTTTGCACATCAGAAGTCAGGATTTGGTATCAGCACTAAATTGTGGGATTACTGTTTCCACACCCTCACTCCAGAGAAACCCCACCT

Numéro d'accès Ensembl | humain

ENSG00000103089

Numéro d'accès NCBI

NM_024306

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FA2H(79152) , FA2H(79152)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Masayo Hirao-Suzuki et al.
Biochemical and biophysical research communications, 531(2), 215-222 (2020-08-17)
The functional role of fatty acid 2-hydroxylase (FA2H) is controversial in the field of cancer biology due to the dual role of FA2H, particularly related to its interaction with triple-negative breast cancer (TNBC). A previous biochemical- and clinical-focused study suggested
Bo Hong et al.
Open medicine (Warsaw, Poland), 15(1), 882-889 (2020-12-22)
MicroRNA (miR/miRNA) expression disorders play a crucial role in the development of gastric cancer (GC). Increasing evidence has indicated that miRNAs participate in the process of numerous cancers. Previous research has demonstrated that miR-300 acts as a cancer-promoting factor or
Bishuang Gong et al.
Molecular immunology, 122, 173-185 (2020-05-07)
Thymic epithelial cells (TECs) are essential regulators of T cell development and selection. microRNAs (miRNAs) play critical roles in regulating TECs proliferation during thymus involution. miR-205-5p is highly expressed in TECs and increases with age. However, the function and potential
Janani Ravi et al.
Oncotarget, 5(9), 2475-2486 (2014-05-09)
The endocannabinoid anandamide (AEA), a neurotransmitter was shown to have anti-cancer effects. Fatty acid amide hydrolase (FAAH) metabolizes AEA and decreases its anti-tumorigenic activity. In this study, we have analyzed the role of FAAH inhibition in non-small cell lung cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique