Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU048411

Sigma-Aldrich

MISSION® esiRNA

targeting human WRN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCACGGAGGGTTTCTATCTTACTAAAGGATATTTCAGAAAATCTATATTCACTGAGGAGGATGATAATTGGGTCTACTAACATTGAGACTGAACTGAGGCCCAGCAATAATTTAAACTTATTATCCTTTGAAGATTCAACTACTGGGGGAGTACAACAGAAACAAATTAGAGAACATGAAGTTTTAATTCACGTTGAAGATGAAACATGGGACCCAACACTTGATCATTTAGCTAAACATGATGGAGAAGATGTACTTGGAAATAAAGTGGAACGAAAAGAAGATGGATTTGAAGATGGAGTAGAAGACAACAAATTGAAAGAGAATATGGAAAGAGCTTGTTTGATGTCGTTAGATATTACAGAACATGAACTCCAAATTTTGGAACAGCAGTCTCAGGA

Numéro d'accès Ensembl | humain

ENSG00000165392

Numéro d'accès NCBI

NM_000553

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... WRN(7486) , WRN(7486)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Niek van Wietmarschen et al.
Nature, 586(7828), 292-298 (2020-10-02)
The RecQ DNA helicase WRN is a synthetic lethal target for cancer cells with microsatellite instability (MSI), a form of genetic hypermutability that arises from impaired mismatch repair1-4. Depletion of WRN induces widespread DNA double-strand breaks in MSI cells, leading
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Jyotirindra Maity et al.
DNA repair, 68, 1-11 (2018-05-26)
Impaired autophagy may be associated with normal and pathological aging. Here we explore a link between autophagy and domain function of Werner protein (WRNp). Werner (WRN) mutant cell lines AG11395, AG05229 and normal aged fibroblast AG13129 display a deficient response
Edmond M Chan et al.
Nature, 568(7753), 551-556 (2019-04-12)
Synthetic lethality-an interaction between two genetic events through which the co-occurrence of these two genetic events leads to cell death, but each event alone does not-can be exploited for cancer therapeutics1. DNA repair processes represent attractive synthetic lethal targets, because
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique