Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU044261

Sigma-Aldrich

MISSION® esiRNA

targeting human CNR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTCTGAGGATGGGAAGGTACAGGTGACCCGGCCAGACCAAGCCCGCATGGACATTAGGTTAGCCAAGACCCTGGTCCTGATCCTGGTGGTGTTGATCATCTGCTGGGGCCCTCTGCTTGCAATCATGGTGTATGATGTCTTTGGGAAGATGAACAAGCTCATTAAGACGGTGTTTGCATTCTGCAGTATGCTCTGCCTGCTGAACTCCACCGTGAACCCCATCATCTATGCTCTGAGGAGTAAGGACCTGCGACACGCTTTCCGGAGCATGTTTCCCTCTTGTGAAGGCACTGCGCAGCCTCTGGATAACAGCATGGGGGACTCGGACTGCCTGCACAAACACGCAAACAATGCAGCCAGTGTTCACAGGGCCGCAGAAAGCTGCATCAAGAGCACGGTCAAGA

Numéro d'accès Ensembl | humain

ENSG00000118432

Numéro d'accès NCBI

NM_033181

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CNR1(1268) , CNR1(1268)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Le Yang et al.
Molecular therapy. Nucleic acids, 20, 725-738 (2020-05-15)
Nod-like receptor (NLR) family pyrin domain containing 3 (NLRP3) has been regarded as an important initiator or promoter in multiple inflammatory diseases. However, the relationship between cannabinoid receptor 1 (CB1) and macrophage NLRP3 inflammasome and the corresponding molecular mechanism in
Chih-Yuan Lin et al.
Journal of molecular and cellular cardiology, 85, 249-261 (2015-06-21)
Cannabinoid receptor type 1 (CB1R) plays an important role in the development of myocardial hypertrophy and fibrosis-2 pathological features of uremic cardiomyopathy. However, it remains unknown whether CB1R is involved in the pathogenesis of uremic cardiomyopathy. Here, we aimed to
Elena Ciaglia et al.
Oncotarget, 6(17), 15464-15481 (2015-05-27)
Herein we show that a majority of human brain tumor samples and cell lines over-expressed cannabinoid receptor CB1 as compared to normal human astrocytes (NHA), while uniformly expressed low levels of CB2. This finding prompted us to investigate the therapeutic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique