Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU043701

Sigma-Aldrich

MISSION® esiRNA

targeting human BATF

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGCAAACAGGACTCATCTGATGATGTGAGAAGAGTTCAGAGGAGGGAGAAAAATCGTATTGCCGCCCAGAAGAGCCGACAGAGGCAGACACAGAAGGCCGACACCCTGCACCTGGAGAGCGAAGACCTGGAGAAACAGAACGCGGCTCTACGCAAGGAGATCAAGCAGCTCACAGAGGAACTGAAGTACTTCACGTCGGTGCTGAACAGCCACGAGCCCCTGTGCTCGGTGCTGGCCGCCAGCACGCCCTCGCCCCCCGAGGTGGTGTACAGCGCCCACGCATTCCACCAACCTCATGTCAGCTCCCCGCGCTTCCAGCCCTGAGCTTCCGATGCGGGGAGAGCAGAGCCTCGGGAGGGGCACACAGACTGTGGCAGAGCTGCGCCCATCCCGCAGAGGCCCCTGTCCACCTGGAGACCCGGAGACAGAGGCCTGGACAAGGAGTGAACACGGGAACTGT

Numéro d'accès Ensembl | humain

ENSG00000156127

Numéro d'accès NCBI

NM_006399

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... BATF(10538) , BATF(10538)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jia-Yu Zhong et al.
Annals of the New York Academy of Sciences, 1474(1), 61-72 (2020-06-03)
Long noncoding RNAs (lncRNAs) have been investigated as novel regulatory molecules involved in diverse biological processes. Our previous study demonstrated that lncRNA-ES3 is associated with the high glucose-induced calcification/senescence of human aortic vascular smooth muscle cells (HA-VSMCs). However, the mechanism
Sahil Gupta et al.
Oncoimmunology, 7(10), e1494110-e1494110 (2018-10-06)
Macrophages in the tumor microenvironment respond to complex cytokine signals. How these responses shape the phenotype of tumor-associated macrophages (TAMs) is incompletely understood. Here we explored how cytokines of the tumor milieu, interleukin (IL)-6 and IL-4, interact to influence target

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique