Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU041011

Sigma-Aldrich

MISSION® esiRNA

targeting human HPSE

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCGAATGGGAATAGAAGTGGTGATGAGGCAAGTATTCTTTGGAGCAGGAAACTACCATTTAGTGGATGAAAACTTCGATCCTTTACCTGATTATTGGCTATCTCTTCTGTTCAAGAAATTGGTGGGCACCAAGGTGTTAATGGCAAGCGTGCAAGGTTCAAAGAGAAGGAAGCTTCGAGTATACCTTCATTGCACAAACACTGACAATCCAAGGTATAAAGAAGGAGATTTAACTCTGTATGCCATAAACCTCCATAATGTCACCAAGTACTTGCGGTTACCCTATCCTTTTTCTAACAAGCAAGTGGATAAATACCTTCTAAGACCTTTGGGACCTCATGGATTACTTTCCAAATCTGTCCAACTCAATGGTCTAACTCTAAAGATGGTGGATGATCAAACCTTGCCACCTTTAATGGAA

Numéro d'accès Ensembl | humain

ENSG00000173083

Numéro d'accès NCBI

NM_006665

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HPSE(10855) , HPSE(10855)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haiyan Zheng et al.
Cancer biomarkers : section A of Disease markers, 15(5), 525-534 (2015-01-15)
Heparanase(HPSE), an endo-β -D-glucuronidase, is found overexpressed in Ovarian cancer (OC). The purpose of our work was to investigate primitively the possible role of HPSE in the development of OC. In this study, RNA interference (RNAi) with a HPSE small
Uri Barash et al.
International journal of cancer, 145(6), 1596-1608 (2019-04-30)
Heparanase is an endo-β-d-glucuronidase that cleaves heparan sulfate (HS) side chains of heparan sulfate proteoglycans. Compelling evidence tie heparanase levels with all steps of tumor formation including tumor initiation, growth, metastasis and chemo-resistance, likely involving augmentation of signaling pathways and
Jianping Li et al.
American journal of cancer research, 7(2), 234-244 (2017-03-25)
Heparanase (HPSE1) is elevated in various types of cancers including cervical cancer, and correlated with poor prognosis. Current study is to investigate the effects of HPSE1 on radiation response in cervical cancer. Colony formation assays after radiation were performed to
Marjolein Garsen et al.
The American journal of pathology, 186(4), 805-815 (2016-02-14)
Heparanase, a heparan sulfate (HS)--specific endoglucuronidase, mediates the onset of proteinuria and renal damage during experimental diabetic nephropathy. Glomerular heparanase expression is increased in most proteinuric diseases. Herein, we evaluated the role of heparanase in two models of experimental glomerulonephritis
Satvik R Hadigal et al.
Nature communications, 6, 6985-6985 (2015-04-29)
Herpesviruses exemplified by herpes simplex virus-1 (HSV-1) attach to cell surface heparan sulfate (HS) for entry into host cells. However, during a productive infection, the HS moieties on parent cells can trap newly exiting viral progenies and inhibit their release.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique