Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU039481

Sigma-Aldrich

MISSION® esiRNA

targeting human CLTC

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGA

Numéro d'accès Ensembl | humain

ENSG00000141367

Numéro d'accès NCBI

NM_004859

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLTC(1213) , CLTC(1213)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jiao Liu et al.
Science signaling, 12(585) (2019-06-13)
Transient receptor potential vanilloid 1 (TRPV1), a nonselective, ligand-gated cation channel, responds to multiple noxious stimuli and is targeted by many kinases that influence its trafficking and activity. Studies on the internalization of TRPV1 have mainly focused on that induced
Min Feng et al.
Virus research, 253, 12-19 (2018-05-29)
Bombyx mori nucleopolyhedrovirus (BmNPV) is a leading cause of silkworm mortality and economic loss to sericulture. The entry of BmNPV budded virus (BV) into host cells is a fundamental process required for the initiation of infection. However, our understanding of
Zhenzhu Jiang et al.
Anti-cancer drugs, 32(1), 1-10 (2020-09-16)
Circular RNAs are involved in the occurrence and development of different types of cancers. We aimed to illustrate the expression profile and mechanism of circ_0074027 in non-small cell lung cancer (NSCLC). Quantitative real-time PCR was employed to detect the expression
Lei Miao et al.
Nature communications, 11(1), 2424-2424 (2020-05-18)
Lipid-like nanoparticles (LNPs) have potential as non-viral delivery systems for mRNA therapies. However, repeated administrations of LNPs may lead to accumulation of delivery materials and associated toxicity. To address this challenge, we have developed biodegradable lipids which improve LNPs clearance
Ruobo Zhou et al.
Science (New York, N.Y.), 365(6456), 929-934 (2019-08-31)
Actin, spectrin, and related molecules form a membrane-associated periodic skeleton (MPS) in neurons. The function of the MPS, however, remains poorly understood. Using super-resolution imaging, we observed that G protein-coupled receptors (GPCRs), cell adhesion molecules (CAMs), receptor tyrosine kinases (RTKs)
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique