Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU035901

Sigma-Aldrich

MISSION® esiRNA

targeting human AP2M1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAAAGGCACAGCTGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACTGCACCTTCCACCAGTGTGTGCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTTATCCCGCCAGATGGAGAGTTTGAGCTTATGAGGTATCGCACAACCAAGGACATCATCCTTCCCTTCCGGGTGATCCCGCTAGTGCGAGAAGTGGGACGCACCAAACTGGAGGTCAAGGTGGTCATCAAGTCCAACTTTAAACCCTCACTGCTGGCTCAGAAGATCGAGGTGAGGATCCCAACCCCACTGAACACAAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCCAAGTACAAGGCCAGCGAGAATGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCGCAGATCAGCGCAGAGATTGAGCTTCTGCCTACCAACGACAAGAAGAAATGGGCTCG

Numéro d'accès Ensembl | humain

ENSG00000161203

Numéro d'accès NCBI

NM_004068

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AP2M1(1173) , AP2M1(1173)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Frederic Daste et al.
The Journal of cell biology, 216(11), 3745-3765 (2017-09-20)
The conditional use of actin during clathrin-mediated endocytosis in mammalian cells suggests that the cell controls whether and how actin is used. Using a combination of biochemical reconstitution and mammalian cell culture, we elucidate a mechanism by which the coincidence
Shuofeng Yuan et al.
Science advances, 6(35), eaba7910-eaba7910 (2020-09-15)
Targeting a universal host protein exploited by most viruses would be a game-changing strategy that offers broad-spectrum solution and rapid pandemic control including the current COVID-19. Here, we found a common YxxØ-motif of multiple viruses that exploits host AP2M1 for
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique