Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU035381

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG

Numéro d'accès Ensembl | humain

ENSG00000118515

Numéro d'accès NCBI

NM_005627

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SGK1(6446) , SGK1(6446)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Florian Poetsch et al.
International journal of molecular sciences, 21(19) (2020-10-03)
In diabetes mellitus, hyperglycemia promotes the osteogenic transdifferentiation of vascular smooth muscle cells (VSMCs) to enhance medial vascular calcification, a common complication strongly associated with cardiovascular disease and mortality. The mechanisms involved are, however, still poorly understood. Therefore, the present
Nadeshda Schelski et al.
Pflugers Archiv : European journal of physiology, 471(6), 889-899 (2019-02-02)
The serum- and glucocorticoid-inducible kinase 1 (SGK1) is a key regulator of osteo-/chondrogenic transdifferentiation and subsequent calcification of vascular smooth muscle cells (VSMCs). The phenotypical transdifferentiation of VSMCs is associated with increased interleukin-18 (IL-18) levels and generalized inflammation. Therefore, the
Ferran Medina-Jover et al.
FEBS letters, 594(19), 3200-3215 (2020-08-09)
BMP9 is a cytokine involved in the maturation phase of the angiogenic process that signals through its serine/threonine receptor ALK1 and its coreceptor endoglin. In this paper, we explain how BMP9 directs the regulation of endothelial cell proliferation blockage while
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique