Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU034581

Sigma-Aldrich

MISSION® esiRNA

targeting human GOLPH3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCAACAGGGGATGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAAACTCAGCCTCCAGAAACGGTCCAGAACTGGATTGAATTACTTAGTGGTGAGACATGGAATCCATTAAAATTGCATTATCAGTTAAGAAATGTACGGGAACGATTAGCTAAAAACCTGGTGGAAAAGGGTGTATTGACAACAGAGAAACAGAACTTCCTACTTTTTGACATGACAACACATCCCCTCACCAATAACAACATTAAGCAGCGCCTCATCAAGAAAGTACAGGAAGCCGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAGGCGCTTGCTGGCCCTCATTTACCTGGCTCATGCCTCGGACGTCCTGGAGAATGCTTTTGCTCCTCTTCTGGACGAGCAGTATGATTTGGCTACCAAGAGAGTGCGGCAGCTTCTCGACTTAGACCCTGAAGTGGAATGTCTGAAGGCCA

Numéro d'accès Ensembl | humain

ENSG00000113384

Numéro d'accès NCBI

NM_022130

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GOLPH3(64083) , GOLPH3(64083)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Dong Lu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 47(6), 2445-2457 (2018-07-11)
Golgi phosphoprotein 3 (GOLPH3) plays pro-malignancy roles in several types of cancer. However, the molecular mechanism underlying GOLPH3 promoting tumor progression remains poorly understood. The expression of GOLPH3 and Wntless (Wls) in glioma tissues was examined by western blotting and
Tao Yu et al.
Life sciences, 260, 118294-118294 (2020-08-21)
To explore whether GOLPH3 regulated oxaliplatin (L-OHP) resistance of colon cancer cells via PI3K/AKT/mTOR pathway. HCT116/L-OHP cells were divided into Blank, Control/GOLPH3 shRNA, BEZ235 (a PI3K/AKT/mTOR inhibitor), and GOLPH3 + BEZ235 groups followed by the detection with MTT, soft agar colony formation
Qian Li et al.
Molecular medicine reports, 11(6), 4315-4320 (2015-01-31)
Golgi phosphoprotein 3 (GOLPH3) overexpression has previously been associated with the progression of several solid tumors, which resulted in adverse clinical outcomes. The present study aimed to determine the expression and prognostic significance of GOLPH3 in human hepatocellular carcinoma (HCC). GOLPH3

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique