Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU030101

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6KA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGGCACCTGTATGCTATGAAGGTGCTGAAGAAGGCAACGCTGAAAGTACGTGACCGCGTCCGGACCAAGATGGAGAGAGACATCCTGGCTGATGTAAATCACCCATTCGTGGTGAAGCTGCACTATGCCTTCCAGACCGAGGGCAAGCTCTATCTCATTCTGGACTTCCTGCGTGGTGGGGACCTCTTCACCCGGCTCTCAAAAGAGGTGATGTTCACGGAGGAGGATGTGAAGTTTTACCTGGCTGAGCTGGCTCTGGGCCTGGATCACCTGCACAGCCTGGGTATCATTTACAGAGACCTCAAGCCTGAGAACATCCTTCTGGATGAGGAGGGCCACATCAAACTCACTGACTTTGGCCTGAGCAAAGAGGCCATTGACCACGAGAAGAAGGCCTATTCTTTCTGCGGGACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shu-Ching Ou et al.
International journal of molecular sciences, 21(23) (2020-12-03)
Lung epithelial cells play critical roles in idiopathic pulmonary fibrosis. In the present study, we investigated whether transforming growth factor-β (TGF-β)-induced expression of connective tissue growth factor (CTGF) was regulated by the extracellular signal-regulated kinase (ERK)/a disintegrin and metalloproteinase 17
Luis Carretero et al.
Cellular signalling, 27(9), 1720-1730 (2015-05-30)
The transduction pathway mediating the inhibitory effect that TRH exerts on r-ERG channels has been thoroughly studied in GH3 rat pituitary cells but some elements have yet to be discovered, including those involved in a phosphorylation event(s). Using a quantitative

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique