Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU027981

Sigma-Aldrich

MISSION® esiRNA

targeting human GJA5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTTATGGCCAGAAGCCTGAGGTGCCCAATGGAGTCTCACCAGGTCACCGCCTTCCCCATGGCTATCATAGTGACAAGCGACGTCTTAGTAAGGCCAGCAGCAAGGCAAGGTCAGATGACCTATCAGTGTGACCCTCCTTTATGGGAGGATCAGGACCAGGTGGGAACAAAGGAGGCTCAGAGAAGAAAGACGTGTCCCTTCTGAACTGATGCTTTCTCACTGTCATCACTGCTTGGCTCCTTTGAGCCCCGGGTCTCAATGACGTTGCTCATTAATTCTAGAAACTATAACCAGGGCTCTGGGATAGTAAGAGAGGTGACAACCCACCCAGACTGCAGTTCCCTCCCCACCCTCTACCCAGTATACGAAGCCTTTCAGATTACTCATGAAACAGGGTAGAGGGAAAGAAGGGAAGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jacques-Antoine Haefliger et al.
Arteriosclerosis, thrombosis, and vascular biology, 37(11), 2136-2146 (2017-10-07)
Cx40 (Connexin40) forms intercellular channels that coordinate the electric conduction in the heart and the vasomotor tone in large vessels. The protein was shown to regulate tumoral angiogenesis; however, whether Cx40 also contributes to physiological angiogenesis is still unknown. Here
Ping Dai et al.
Scientific reports, 4, 7323-7323 (2014-12-05)
The reprogramming of differentiated cells into induced pluripotent stem cells (iPSCs) can be achieved by ectopic expression of defined transcription factors (Oct3/4, Sox2, Klf4 and c-Myc). However, to date, some iPSCs have been generated using viral vectors; thus, unexpected insertional

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique