Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU027141

Sigma-Aldrich

MISSION® esiRNA

targeting human PTN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGTGCAAGCAAACCATGAAGACCCAGAGATGTAAGATCCCCTGCAACTGGAAGAAGCAATTTGGCGCGGAGTGCAAATACCAGTTCCAGGCCTGGGGAGAATGTGACCTGAACACAGCCCTGAAGACCAGAACTGGAAGTCTGAAGCGAGCCCTGCACAATGCCGAATGCCAGAAGACTGTCACCATCTCCAAGCCCTGTGGCAAACTGACCAAGCCCAAACCTCAAGCAGAATCTAAGAAGAAGAAAAAGGAAGGCAAGAAACAGGAGAAGATGCTGGATTAAAAGATGTCACCTGTGGAACATAAAAAGGACATCAGCAAACAGGATCAGTTAACTATTGCATTTATATGTACCGTAGGCTTTGTATTCAAAAATTATCTATAGCTAAGTACACAATAAGCAAAAACAAAAAGAAAAGAAAATTTTTGTAGTAGCGTTTTTTAAATGTATACTATAGTACCAGTAGGGGCTTATAATAAAGGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Biqiang Zhu et al.
Cancer medicine, 9(2), 783-796 (2020-01-21)
Cholangiocarcinoma is a malignant tumor originating from bile duct epithelium. Currently, the treatment strategy is very limited and the prognosis is poor. Recent studies reported celastrol exhibits antigrowth and antimetastasis properties in many tumors. Our study aimed to assess the
Xingxing Sun et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 128, 110201-110201 (2020-05-28)
Opa-interacting protein 5 antisense RNA1 (OIP5-AS1) has been demonstrated to facilitate proliferation, metastasis and resistance to treatments in various types of cancers. Nevertheless, the exact mechanisms underlying the roles of OIP5-AS1 in osteosarcoma(OS) drug resistance have not yet been clearly
Xue Ding et al.
Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie, 255(5), 873-884 (2017-01-14)
The purpose of our study was to investigate the effects of pleiotrophin (PTN) in proliferative vitreoretinopathy (PVR) both in vitro and in vivo. Immunofluorescence was used to observe the PTN expression in periretinal membrane samples from patients with PVR and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique