Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU015931

Sigma-Aldrich

MISSION® esiRNA

targeting human CARD10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATCCTTCAGCAGCATGTCAGACATCACAGGGAGTGTGACACTTAAGCCCTGGTCCCCTGGCCTCTCTTCGTCCTCATCCTCTGACAGCGTGTGGCCTTTGGGAAAGCCGGAAGGCCTCCTGGCTCGGGGCTGTGGCCTGGACTTCCTCAACAGGTCTCTGGCTATTCGGGTGTCTGGCCGGAGCCCCCCAGGGGGCCCAGAGCCGCAGGACAAGGGACCAGATGGACTGTCGTTTTATGGGGACAGATGGTCTGGGGCTGTGGTGCGCAGGGTGCTGTCTGGGCCTGGGTCCGCCAGGATGGAACCAAGAGAGCAAAGGGTGGAAGCTGCTGGTCTGGAGGGGGCGTGCCTGGAAGCCGAGGCCCAGCAGAGAACCTTGCTCTGGAATCAGGGGTCCACACTCCCCTCCCTGATGGACTCGAAGGCCTGCCAGTCCTTCCACGAGGCCCTAGAAGCCTGGGCAAAGGGACCAGGTGCCGAGCCCTTCTACATTCGTGCCAACCTCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pavithra Shyamsunder et al.
Haematologica, 103(8), 1269-1277 (2018-05-19)
Maturation of granulocytes is dependent on controlled gene expression by myeloid lineage restricted transcription factors. CEBPE is one of the essential transcription factors required for granulocytic differentiation. Identification of downstream targets of CEBPE is vital to understand better its role
Benjamin Causton et al.
Journal of immunology (Baltimore, Md. : 1950), 195(2), 683-694 (2015-06-05)
Innate immune responses to allergens by airway epithelial cells (AECs) help initiate and propagate the adaptive immune response associated with allergic airway inflammation in asthma. Activation of the transcription factor NF-κB in AECs by allergens or secondary mediators via G
Cheng-Shyuan Rau et al.
Toxicological sciences : an official journal of the Society of Toxicology, 140(2), 315-326 (2014-05-28)
This aim of this study was to explore the role of miRNA-146a (miR-146a) and its target genes in endothelial cells. We demonstrated that lipopolysaccharide (LPS) induced the upregulation of miR-146a in human umbilical vein endothelial cells (HUVECs), and that the

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique