Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU014711

Sigma-Aldrich

MISSION® esiRNA

targeting human A4GALT

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCATCGGCTTCAAGTTCACGTTTTTCGTCTCCATCATGATCTACTGGCACGTTGTGGGAGAGCCCAAGGAGAAAGGGCAGCTCTATAACCTGCCAGCAGAGATCCCCTGCCCCACCTTGACACCCCCCACCCCACCCTCCCACGGCCCCACTCCAGGCAACATCTTCTTCCTGGAGACTTCAGACCGGACCAACCCCAACTTCCTGTTCATGTGCTCGGTGGAGTCGGCCGCCAGAACTCACCCCGAATCCCACGTGCTGGTCCTGATGAAAGGGCTTCCGGGTGGCAACGCCTCTCTGCCCCGGCACCTGGGCATCTCACTTCTGAGCTGCTTCCCGAATGTCCAGATGCTCCCGCTGGACCTGCGGGAGCTGTTCCGGGACACACCCCTGGCCGACTGGTACGCGGCCGTGCAGGGGCGCTGGGAGCCCTACCTGCTGCCCGTGCTCTCCGACGCCTCCAGGATCGCACTCATGTGGAAGTTCGGCGGCATCTACCTGGACACGGAC

Numéro d'accès Ensembl | humain

ENSG00000128274

Numéro d'accès NCBI

NM_017436

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... A4GALT(53947) , A4GALT(53947)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
JQS

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shigeki Sugawara et al.
Glycoconjugate journal, 34(1), 127-138 (2016-11-01)
Silurus asotus egg lectin (SAL), an α-galactoside-binding protein isolated from the eggs of catfish, is a member of the rhamnose-binding lectin family that binds to Gb3 glycan (Galα1-4Galβ1-4Glc). We have previously demonstrated that SAL reduces the proliferation of Gb3-expressing Burkitt's
Karl Johansson et al.
Frontiers in cellular and infection microbiology, 10, 212-212 (2020-06-12)
Shiga toxin is the main virulence factor of non-invasive enterohemorrhagic Escherichia coli strains capable of causing hemolytic uremic syndrome. Our group has previously shown that the toxin can reach the kidney within microvesicles where it is taken up by renal
Jonas Bergan et al.
Cellular and molecular life sciences : CMLS, 71(21), 4285-4300 (2014-04-18)
Shiga toxin-producing Escherichia coli bacteria cause hemorrhagic colitis and hemolytic uremic syndrome in humans. Currently, only supportive treatment is available for diagnosed patients. We show here that 24-h pretreatment with an ether lipid precursor, the alkylglycerol sn-1-O-hexadecylglycerol (HG), protects HEp-2

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique