Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU012281

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC14A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCTGGGACAAACTCTCGGGCGATGTGTTGTGTCCCTGCCCCGGGAGGTACCTCCGTGCTGGCAAATGCGCAGAGCTCCCTAACTGCCTAGACGACTTGGGAGGCTTTGCCTGCGAATGTGCTACGGGCTTCGAGCTGGGGAAGGACGGCCGCTCTTGTGTGACCAGTGGGGAAGGACAGCCGACCCTTGGGGGGACCGGGGTGCCCACCAGGCGCCCGCCGGCCACTGCAACCAGCCCCGTGCCGCAGAGAACATGGCCAATCAGGGTCGACGAGAAGCTGGGAGAGACACCACTTGTCCCTGAACAAGACAATTCAGTAACATCTATTCCTGAGATTCCTCGATGGGGATCACAGAGCACGATGTCTACCCTTCAAATGTCCCTTCAAGCCGAGTCAAAGGCCACTATCACCCCATCAGGGAGCGTGATTTCCAAGTTTAATTCTACGACTTCCTCTGCCACTCCTCA

Numéro d'accès Ensembl | humain

ENSG00000176435

Numéro d'accès NCBI

NM_175060

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CLEC14A(161198) , CLEC14A(161198)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yeomyeong Kim et al.
Journal of neuroinflammation, 17(1), 48-48 (2020-02-06)
Ischemic stroke is a main cause of mortality. Blood-brain barrier (BBB) breakdown appears to play a critical role in inflammation in patients with ischemic stroke and acceleration of brain injury. The BBB has a protective function and is composed of
Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
P J Noy et al.
Oncogene, 34(47), 5821-5831 (2015-03-10)
We previously identified CLEC14A as a tumour endothelial marker. Here we show that CLEC14A is a regulator of sprouting angiogenesis in vitro and in vivo. Using a human umbilical vein endothelial cell spheroid-sprouting assay, we found CLEC14A to be a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique