Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU011481

Sigma-Aldrich

MISSION® esiRNA

targeting human PROM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCGGAAACTGGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCAGAGCAAATCAAATATATATTGGCCCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGAACAGTATCAATTCAGTGCTAGGAGGCGGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCTTGATGAGATTAAGTCCATGGCAACAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTGAATAGCAACCCTGAACTGAGGCAGCTTCCACCCGTGGATGCAGAACTTGACAACGTTAATAACGTTCTTAGGACAGATTTGGATGGCCTGGTCCAACAGGGCTATCAATCC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jong Woo Park et al.
Molecules (Basel, Switzerland), 25(14) (2020-07-12)
The pharmacological effects of BST204-a fermented ginseng extract-on several types of cancers have been reported. However, the effects of ginseng products or single ginsenosides against cancer stem cells are still poorly understood. In this study, we identified the anti-tumorigenic and
Yanli Jin et al.
BMC cancer, 15, 226-226 (2015-04-18)
Acute lymphoblastic leukemia (ALL) is a heterogeneous group of malignant disorders derived from B- or T-cell lymphoid progenitor cells. ALL often is refractory to or relapses after treatment; thus, novel targeted therapy for ALL is urgently needed. In the present
Liang-Yu Lin et al.
Cardiovascular diabetology, 13, 111-111 (2014-07-17)
Circulating endothelial progenitor cells (EPCs) reflect endothelial repair capacity and may be a significant marker for the clinical outcomes of cardiovascular disease. While some high-dose statin treatments may improve endothelial function, it is not known whether different statins may have
Hideki Izumi et al.
Scientific reports, 9(1), 2236-2236 (2019-02-21)
CD133 is a transmembranous protein that mainly localises to the plasma membrane in haematopoietic and neural stem cells as well as cancer stem cells. Although CD133 also localises to the cytoplasm, the mechanism of action and function of cytoplasmic CD133
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique