Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU010941

Sigma-Aldrich

MISSION® esiRNA

targeting human CYBB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCGTGGAAACTACCTAAGATAGCGGTTGATGGGCCCTTTGGCACTGCCAGTGAAGATGTGTTCAGCTATGAGGTGGTGATGTTAGTGGGAGCAGGGATTGGGGTCACACCCTTCGCATCCATTCTCAAGTCAGTCTGGTACAAATATTGCAATAACGCCACCAATCTGAAGCTCAAAAAGATCTACTTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCAGATCTGCTGCAACTGCTGGAGAGCCAGATGCAGGAAAGGAACAATGCCGGCTTCCTCAGCTACAACATCTACCTCACTGGCTGGGATGAGTCTCAGGCCAATCACTTTGCTGTGCACCATGATGAGGAGAAAGATGTGATCACAGGCCTGAAACAAAAGACTTTGTATGGACGGCCCAACTGGGATAATGAATTCAAGACAATTGCAAGTCAACACCCTAATACCAGAATAGGAGTTTTCCTCTGTGGACCTGAAGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenjun Wang et al.
Brain research bulletin, 160, 141-149 (2020-05-12)
Sleep deprivation (SD) can induce cognitive and memory impairments. This impairment is in part due to oxidative stress damage in the hippocampus region of the brain. Corilagin (CL), a polyphenol belonging to the tannin family and extracted from Terminalia chebula
Young-Mee Kim et al.
American journal of physiology. Cell physiology, 312(6), C749-C764 (2017-04-21)
Reactive oxygen species (ROS) derived from NADPH oxidase (NOX) and mitochondria play a critical role in growth factor-induced switch from a quiescent to an angiogenic phenotype in endothelial cells (ECs). However, how highly diffusible ROS produced from different sources can
Xianzhang Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 783-797 (2018-10-15)
Peri-operative cerebral ischemia reperfusion injury is one of the most serious peri-operative complications that can be aggravated in patients with diabetes. A previous study showed that microglia NOX2 (a NADPH oxidase enzyme) may play an important role in this process.
Jing Li et al.
Pathology, research and practice, 214(7), 925-933 (2018-06-03)
Aberrant proliferation and migration of retinal pigment epithelium (RPE) cells contributes to the pathology of various ocular diseases. miR-27b has been reported to be crucial in the regulation of cell differentiation, proliferation, apoptosis, and migration. However, the role of miR-27b
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique