Skip to Content
Merck
All Photos(1)

Key Documents

EMU037311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Adam17

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAGCCACTTTGGAGGTTTGTCAATGATACTAAAGATAAACGAATGCTGGTGTATAAGTCTGAAGATATCAAGGATTTTTCACGTTTGCAGTCTCCAAAAGTATGTGGTTATTTAAATGCAGATAGTGAAGAGCTGCTTCCAAAAGGGCTCATAGACAGAGAGCCATCTGAAGAGTTTGTTCGTCGAGTGAAGAGACGAGCTGAACCTAACCCCTTGAAGAATACTTGTAAATTACTGGTGGTAGCAGATCATCGATTTTATAAATACATGGGCCGTGGCGAAGAGAGCACCACTACAAATTACTTAATAGAGCTAATTGACCGAGTTGATGACATATACCGGAACACGTCGTGGGATAATGCAGGGTTTAAAGGTTATGGAGTGCAGATAGAGCAGATTCGAATTCTCAAGTCTCCACAAGAGGTAAAACCTGGTGAAAGACACTTCAATATGGCAAAAAGTTTCCCAAACGAAGAGAAGGATGCTTGGGATGTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dong Fan et al.
Circulation. Heart failure, 8(5), 970-979 (2015-07-03)
A disintegrin and metalloproteinase 17 (ADAM17) is a membrane-bound enzyme that mediates shedding of many membrane-bound molecules, thereby regulating multiple cellular responses. We investigated the role of cardiomyocyte ADAM17 in myocardial infarction (MI). Cardiomyocyte-specific ADAM17 knockdown mice (ADAM17(flox/flox)/α-MHC-Cre; f/f/Cre) and
Qin Xu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(8), 7575-7586 (2014-05-06)
Metalloproteinase activities of a disintegrin and metalloproteinase 17 (ADAM17), amphiregulin (AREG), extracellular matrix metalloproteinase inducer (EMMPRIN), and matrix metalloproteinases (MMPs) are involved in tumor biology. In patients with uterine cervical carcinoma, the expression and prognostic significance of ADAM17 remain to
Yang Wu et al.
FEBS letters, 588(12), 2063-2069 (2014-05-13)
As a cleavage enzyme of precursor TNF-α, the high expression level of ADAM17 in endothelial cells is an important factor in atherosclerosis. In this study, we demonstrate that ADAM17 is the target of miR-152. We found that miR-152 could reduce
Sarah Louise Dombernowsky et al.
Nature communications, 6, 7518-7518 (2015-06-26)
The metalloproteinase ADAM17 activates ErbB signalling by releasing ligands from the cell surface, a key step underlying epithelial development, growth and tumour progression. However, mechanisms acutely controlling ADAM17 cell-surface availability to modulate the extent of ErbB ligand release are poorly

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service