Skip to Content
Merck
All Photos(1)

Key Documents

EHU145981

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL11A

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTCAGGACTAGGTGCAGAATGTCCTTCCCAGCCACCTCTCCATGGGATTCATATTGCAGACAATAACCCCTTTAACCTGCTAAGAATACCAGGATCAGTATCGAGAGAGGCTTCCGGCCTGGCAGAAGGGCGCTTTCCACCCACTCCCCCCCTGTTTAGTCCACCACCGAGACATCACTTGGACCCCCACCGCATAGAGCGCCTGGGGGCGGAAGAGATGGCCCTGGCCACCCATCACCCGAGTGCCTTTGACAGGGTGCTGCGGTTGAATCCAATGGCTATGGAGCCTCCCGCCATGGATTTCTCTAGGAGACTTAGAGAGCTGGCAGGGAACACGTCTAGCCCACCGCTGTCCCCAGGCCGGCCCAGCCCTATGCAAAGGTTACTGCAACCATTCCAGCCAGGTAGCAAGCCGCCCTTCCTGGCGACGCCCCCCCTCCCTCCTCTGCAATCCGCCCCTCCTCCCTCCCAGCCCCCGGTCAAGTCCAAGTCATGCGAGTTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chen-Han Zhang et al.
Oncotarget, 8(51), 88658-88669 (2017-11-29)
Tamoxifen resistance is a serious problem in the endocrine therapy of breast cancer. Long non-coding RNAs play important roles in tumor development. In this study, we revealed the involvement of lncRNA uc.57 and its downstream gene BCL11A in TAM resistance.
Samarwadee Plianwong et al.
Pharmaceutical research, 37(3), 46-46 (2020-02-06)
Short interfering RNA (siRNA) therapy promises a new era in treatment of breast cancers but effective delivery systems are needed for clinical use. Since silencing complementary targets may offer improved efficacy, this study was undertaken to identify non-viral carriers for
Alberto Daniel-Moreno et al.
Blood cells, molecules & diseases, 84, 102456-102456 (2020-06-05)
β-Hemoglobinopathies are among the most common single-gene disorders and are caused by different mutations in the β-globin gene. Recent curative therapeutic approaches for these disorders utilize lentiviral vectors (LVs) to introduce a functional copy of the β-globin gene into the
Petros Papadopoulos et al.
Human genomics, 14(1), 39-39 (2020-10-18)
The expression of the human β-like globin genes follows a well-orchestrated developmental pattern, undergoing two essential switches, the first one during the first weeks of gestation (ε to γ), and the second one during the perinatal period (γ to β).

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service