Skip to Content
Merck
All Photos(1)

Key Documents

EHU138571

Sigma-Aldrich

MISSION® esiRNA

targeting human GPR50

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTTTATGTTCTGCGCGATGGTTATCACCATCGTTGTAGACCTAATCGGCAACTCCATGGTCATTTTGGCTGTGACGAAGAACAAGAAGCTCCGGAATTCTGGCAACATCTTCGTGGTCAGTCTCTCTGTGGCCGATATGCTGGTGGCCATCTACCCATACCCTTTGATGCTGCATGCCATGTCCATTGGGGGCTGGGATCTGAGCCAGTTACAGTGCCAGATGGTCGGGTTCATCACAGGGCTGAGTGTGGTCGGCTCCATCTTCAACATCGTGGCAATCGCTATCAACCGTTACTGCTACATCTGCCACAGCCTCCAGTACGAACGGATCTTCAGTGTGCGCAATACCTGCATCTACCTGGTCATCACCTGGATCATGACCGTCCTGGCTGTCCTGCCCAACATGTACATTGGCACCATCGAGTACGATCCTCGCACCTACACCTGCATCTTCAACTATCTGAACAACCCTGTCTTCACTGTTACCATCGTCTGCATCCACTTCGTCCTCCCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lili Xu et al.
The American journal of Chinese medicine, 48(4), 945-966 (2020-06-02)
Tetramethylpyrazine has shown neuroprotective and axonal outgrowth-promoting effects and can improve cognitive deficit in a rat model of chronic hypoperfusion. However, the role of tetramethylpyrazine in sevoflurane-induced neurotoxicity is still vague. Therefore, this study was designed to investigate the effects
Jin-Young Sung et al.
Molecules (Basel, Switzerland), 23(4) (2018-03-24)
The activation of cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB) via phosphorylation in the hippocampus is an important signaling mechanism for enhancing memory processing. Although melatonin is known to increase CREB expression in various animal models, the signaling mechanism

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service