Skip to Content
Merck
All Photos(1)

Documents

EHU126851

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGATCACTTGGGTGGTGGCTGTGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACACCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAATCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTATCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCCTGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACCAAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCTATGCCTTTGTCGGGGAGAAGTTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Silvia Waldeck et al.
Molecular oncology, 14(4), 779-794 (2020-01-20)
FLT3-ITD tyrosine kinase inhibitors (TKI) show limited clinical activity in acute myeloid leukemia (AML) due to emerging resistance. TKI resistance is mediated by secondary FLT3-ITD mutations only in a minority of cases. We hypothesize that the cytokine CCL5 protects AML
Asim Pervaiz et al.
Journal of cancer research and clinical oncology, 147(1), 73-91 (2020-09-10)
Liver metastasis is observed in up to 50% of colorectal cancer (CRC) patients. Available treatment options are limited and disease recurrence is often. Chemokine receptor 5 (CCR5) has attracted attention as novel therapeutic target for treating cancers. In this study
Ying Wang et al.
Oncology reports, 36(6), 3522-3528 (2016-10-18)
Glioblastoma (GBM) is a highly malignant brain tumor characterized by invasion tendency. Macrophage infiltration is associated with GBM invasion, but the mechanisms remain unclear. Hypoxia is an outstanding characteristic of GBM tissue. Hypoxia microenvironment modulates the biological behaviors of both tumor
Sandra Zazo et al.
Molecular cancer therapeutics, 19(8), 1696-1707 (2020-05-15)
HER2-positive breast cancer is currently managed with chemotherapy in combination with specific anti-HER2 therapies, including trastuzumab. However, a high percentage of patients with HER2-positive tumors do not respond to trastuzumab (primary resistance) or either recur (acquired resistance), mostly due to
Takayuki Kodama et al.
Laboratory investigation; a journal of technical methods and pathology, 100(9), 1140-1157 (2020-05-28)
Tumor-associated macrophages (TAMs) contribute to the progression and mortality of various malignancies. We reported that high numbers of infiltrating TAMs were significantly associated with tumor progression and poor prognosis in esophageal squamous cell carcinoma (ESCC). In our previous investigation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service