Skip to Content
Merck
All Photos(1)

Key Documents

EHU121841

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTGGTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTCCGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGCATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAAAACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCATGACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sayem Miah et al.
BMC cancer, 19(1), 78-78 (2019-01-18)
BRK is, a non-receptor tyrosine kinase, overexpressed in approximately 85% of human invasive ductal breast tumors. It is not clear whether BRK expression correlates with breast cancer subtypes, or the expression has prognostic or diagnostic significance. Herein, we investigated the
Tao Li et al.
Cancer management and research, 12, 6477-6491 (2020-08-18)
Serum response factor (SRF), a sequence-specific transcription factor, is closely related to metastasis of gastric cancer, a digestive tract cancer. Herein, we probed the effect of SRF on metastasis and progression of colon cancer (CC), another digestive tract disorder, and
Xiaohong Chen et al.
American journal of translational research, 8(10), 4354-4361 (2016-11-11)
Protein tyrosine kinase 6 (PTK6) is a nonreceptor tyrosine kinase that plays a crucial role in some tumors. However, the role of PTK6 is still unknown in hepatocellular carcinoma (HCC). In this study, we demonstrated that the PTK6 expression was

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service