Skip to Content
Merck
All Photos(1)

Key Documents

EHU108861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF2BP3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTATCAGTCGGTGCCATCATCGGCAAGCAGGGCCAGCACATCAAGCAGCTTTCTCGCTTTGCTGGAGCTTCAATTAAGATTGCTCCAGCGGAAGCACCAGATGCTAAAGTGAGGATGGTGATTATCACTGGACCACCAGAGGCTCAGTTCAAGGCTCAGGGAAGAATTTATGGAAAAATTAAAGAAGAAAACTTTGTTAGTCCTAAAGAAGAGGTGAAACTTGAAGCTCATATCAGAGTGCCATCCTTTGCTGCTGGCAGAGTTATTGGAAAAGGAGGCAAAACGGTGAATGAACTTCAGAATTTGTCAAGTGCAGAAGTTGTTGTCCCTCGTGACCAGACACCTGATGAGAATGACCAAGTGGTTGTCAAAATAACTGGTCACTTCTATGCTTGCCAGGTTGCCCAGAGAAAAATTCAGGAAATTCTGACTCAGGTAAAGCAGCACCAACAACAGAAGGCTCTGCAAAGTGGAC

Ensembl | human accession no.

ENSG00000136231

NCBI accession no.

NM_006547

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IGF2BP3(10643) , IGF2BP3(10643)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huidi Liu et al.
Frontiers in oncology, 9, 1570-1570 (2020-02-23)
Ovarian Clear Cell Carcinoma (OCCC) displays distinctive clinical and molecular characteristics and confers the worst prognosis among all ovarian carcinoma histotypes when diagnosed at advanced stage, because of the lack of effective therapy. IGF2BP3 is an RNA binding protein that
Yonglei Liu et al.
Journal of cellular and molecular medicine, 21(9), 1979-1988 (2017-05-20)
CD44, a cell adhesion protein, involves in various process in cancer such as cell survival and metastasis. Most researches on CD44 in cancer focus on cancer cells. Recently, it is found that CD44 expression is high in fibroblasts of tumour
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service