Skip to Content
Merck
All Photos(1)

Key Documents

EHU091151

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXK2

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAACGTTCACTGCCCTGTCCAGCGAGAAGAGAGAGAAGCAGGAGGCGTCTGAGTCTCCAGTGAAGGCCGTACAGCCACACATCTCGCCCCTGACCATCAACATTCCAGACACCATGGCCCACCTCATCAGCCCTCTGCCCTCCCCCACGGGAACCATCAGCGCTGCAAACTCCTGCCCCTCCAGCCCCCGGGGAGCGGGGTCTTCAGGGTACAAGGTGGGCCGAGTGATGCCATCTGACCTCAATTTAATGGCTGACAACTCACAGCCTGAAAATGAAAAGGAAGCTTCAGGTGGAGACAGCCCGAAGGATGATTCAAAGCCGCCTTACTCCTACGCGCAGCTGATAGTTCAGGCGATTACGATGGCTCCCGACAAACAGCTCACCCTGAACGGGATTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongni Wang et al.
Journal of diabetes and its complications, 33(5), 374-382 (2019-03-14)
MicroRNAs (miRNAs) have emerged as promising regulators of diabetes mellitus (DM)-induced angiogenic dysfunction in endothelial cells (ECs), but information vis-à-vis the functional roles of distinct miRNAs remain surprisingly scarce. The current study was designed to elucidate the expression and function
Yuping Chen et al.
Science advances, 6(1), eaax5819-eaax5819 (2020-01-09)
Autophagy is an evolutionarily conserved catabolic process, which plays a vital role in removing misfolded proteins and clearing damaged organelles to maintain internal environment homeostasis. Here, we uncovered the checkpoint kinase 2 (CHK2)-FOXK (FOXK1 and FOXK2) axis playing an important

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service