Skip to Content
Merck
All Photos(1)

Key Documents

EHU078971

Sigma-Aldrich

MISSION® esiRNA

targeting human TFRC

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00

Please contact Customer Service for Availability
All Photos(1)

Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00

Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

Ensembl | human accession no.

ENSG00000072274

NCBI accession no.

NM_003234

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFRC(7037) , TFRC(7037)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
VYU
XVU
URU
FQU
SOU

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xinjian Lin et al.
Oncoscience, 1(3), 185-195 (2015-01-17)
The αV integrin is expressed in most cancer cells where it regulates a diverse array of cellular functions essential to the initiation, progression and metastasis of solid tumors. However, little is known about how αV integrin modulates cellular sensitivity to
Josephine Sui-Yan Au et al.
The Journal of cell biology, 177(1), 103-114 (2007-04-04)
In polarized epithelial cells, newly synthesized membrane proteins are delivered on specific pathways to either the apical or basolateral domains, depending on the sorting motifs present in these proteins. Because myosin VI has been shown to facilitate secretory traffic in
K Kobayashi et al.
Clinical and experimental immunology, 199(3), 326-336 (2019-10-30)
Secretory IgA (SIgA) is a well-known mucosal-surface molecule in first-line defense against extrinsic pathogens and antigens. Its immunomodulatory and pathological roles have also been emphasized, but it is unclear whether it plays a pathological role in lung diseases. In the
Tian Tang et al.
Singapore medical journal, 62(2), 96-103 (2019-11-05)
Dihydroartemisinin (DHA) is a first-line antimalarial drug with relatively low toxicity. DHA has been speculated to possess a broad-spectrum antitumour effect. However, the potential value of DHA for the treatment of endometrial carcinoma or cervical cancer is unclear. We used
Julie Mazzolini et al.
The Biological bulletin, 231(1), 40-60 (2016-09-18)
Particles present in diesel exhaust have been proposed as a significant contributor to the development of acute and chronic lung diseases, including respiratory infection and allergic asthma. Nanoceria (CeO2 nanoparticles) are used to increase fuel efficiency in internal combustion engines
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service