Skip to Content
Merck
All Photos(1)

Key Documents

EHU078371

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP7B

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAAGAGGCTGAGGACTTTGCCCAGGATGACATAGCCAATGGACAAGCAGTGTCTGTCAGCTGTGAAGGCTTCACTCTTATTGTCCTTCTACCTTGAATAGAAGTTTTCCTGATAAGAATAAACGAGGAAAAGGTCCTTGCCTCCTGGAAGAACAAATCTACCAGGTGATCTATTCATTGTTTCAACTCAGAATGCACTTGATTCAGGAGGTCATCTGACCTTCACCTTGGATGGTTAGTTTCACTTTTTACATATAGTTTTTGCAGGGTTTTATTTTATAAAATCCAAGCGCGCTGTTGATTGTGTTTTCCTTGTTTTCAGCCCCCCCACTCCAGCCCGCAGCACATTTCCGCTGTCCGTCAGTAATTGTGTCCTCTCTTTATGCTTGCTTGGGGAATGTTGTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Junko Fujiyoshi et al.
Scientific reports, 9(1), 1535-1535 (2019-02-09)
Wilson's disease (WD) is an inherited metabolic disease arising from ATPase copper transporting beta gene (ATP7B) mutation. Orthotoropic liver transplantation is the only radical treatment of fulminant WD, although appropriate donors are lacking at the onset of emergency. Given the
Navasona Krishnan et al.
Genes & development, 32(13-14), 944-952 (2018-06-28)
The levels of copper, which is an essential element in living organisms, are under tight homeostatic control. Inactivating mutations in ATP7B, a P-type Cu-ATPase that functions in copper excretion, promote aberrant accumulation of the metal, primarily the in liver and
Marta Mariniello et al.
Cancers, 12(3) (2020-03-12)
Tumor resistance to chemotherapy represents an important challenge in modern oncology. Although platinum (Pt)-based drugs have demonstrated excellent therapeutic potential, their effectiveness in a wide range of tumors is limited by the development of resistance mechanisms. One of these mechanisms
Xue Fu et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 432-451 (2014-03-13)
Regulation of cellular copper (Cu) homeostasis involves Cu-transporting ATPases (Cu-ATPases), i.e., ATP7A and ATP7B. The question as to how these Cu-ATPases in brain barrier systems transport Cu, i.e., toward brain parenchyma, cerebrospinal fluid (CSF), or blood, remained unanswered. This study

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service