Skip to Content
Merck
All Photos(1)

Documents

EHU060131

Sigma-Aldrich

MISSION® esiRNA

targeting human IL17RB

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATGCCACTGCTTTCTGTGCAGAACTTCTCCATGTCAAGCAGCAGGTGTCAGCAGGAAAAAGATCACAAGCCTGCCACGATGGCTGCTGCTCCTTGTAGCCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGCTTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTAGCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAAAACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yong-Sheng Teng et al.
Cell death & disease, 10(2), 79-79 (2019-01-30)
Interleukin-17 receptor B (IL-17RB), a member of the IL-17 receptor family activated by IL-17B/IL-17E, has been shown to be involved in inflammatory diseases. However, the regulation and function of IL-17RB in Helicobacter pylori (H. pylori) infection, especially in the early-phase
Suxun Pan et al.
Cell biology international, 44(11), 2220-2230 (2020-07-28)
Interleukin-25 (IL-25) has been recognized as a new member of the IL-17 family and implicated in various inflammatory pathology. We aimed to investigate the effects of IL-25 on the expression of matrix metalloproteinase-2 (MMP-2), MMP-8, and MMP-9 in periodontal fibroblast
Lei Ren et al.
Molecular immunology, 90, 126-135 (2017-07-18)
IL-17RB, a member of the IL-17 receptor family that can be activated by IL-17B, has been proved to be involved in inflammatory diseases and cancers. However, the function of IL-17RB in thyroid cancer is still unknown. In this study, IL-17RB

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service