Skip to Content
Merck
All Photos(1)

Documents

EHU046501

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTGTGAAATCTATTCGAAGTATACCTGCCTACCTTGCAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xujuan Sun et al.
Cell death & disease, 9(6), 637-637 (2018-05-29)
As a calcium-dependent phospholipid binding annexin protein, annexin A5 (Anxa5) links to the progression, metastasis, survival, and prognosis of a variety of cancers. Current work showed ANXA5 overexpression was positively correlated with the upregulations of CRKI/II and RAC1 in hepatocarcinoma
Nahee Park et al.
Journal of toxicology and environmental health. Part A, 77(22-24), 1467-1476 (2014-10-25)
Auranofin is a lipophilic gold compound with anti-inflammatory and immunosuppressive properties. This compound also exerts antiproliferative effects in several human cancer cell lines. Although auranofin induces apoptosis in human cancer cells, the underlying mechanisms remain unclear. This study investigated auranofin-mediated
Jian Zhou et al.
Respiratory research, 19(1), 96-96 (2018-05-23)
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors, including gefitinib, are first-line drugs against advanced non-small cell lung cancer with activating EGFR mutations. However, the development of resistance to such drugs is a major clinical challenge. The role of annexin
Jingjing Wang et al.
Oncology reports, 32(6), 2557-2563 (2014-10-18)
Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin's lymphoma worldwide. Although patient outcomes have significantly improved to a greater than 40% cure rate by the combinatorial cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP) chemotherapy, which is widely

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service