Skip to Content
Merck
All Photos(1)

Documents

EHU030881

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF2AK3, AC104134.2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTATGTAAGGTCAAGGGAGAGAACCTCCTCTTCAATAGTATTTGAAGATTCTGGCTGTGATAATGCTTCCAGTAAAGAAGAGCCGAAAACTAATCGATTGCATATTGGCAACCATTGTGCTAATAAACTAACTGCTTTCAAGCCCACCAGTAGCAAATCTTCTTCTGAAGCTACATTGTCTATTTCTCCTCCAAGACCAACCACTTTAAGTTTAGATCTCACTAAAAACACCACAGAAAAACTCCAGCCCAGTTCACCAAAGGTGTATCTTTACATTCAAATGCAGCTGTGCAGAAAAGAAAACCTCAAAGACTGGATGAATGGACGATGTACCATAGAGGAGAGAGAGAGGAGCGTGTGTCTGCACATCTTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Palsamy Periyasamy et al.
Autophagy, 12(8), 1310-1329 (2016-06-24)
Cocaine is known to induce inflammation, thereby contributing in part, to the pathogenesis of neurodegeneration. A recent study from our lab has revealed a link between macroautophagy/autophagy and microglial activation. The current study was aimed at investigating whether cocaine could
Yanchun Gao et al.
International journal of biological sciences, 16(4), 543-552 (2020-02-07)
Vascular injury is considered an important pathological process during glucocorticoid (GC)-induced osteonecrosis of the femoral head (ONFH). In this study, we tried to investigate whether the endoplasmic reticulum (ER) stress is triggered in the GC-induced endotheliocyte (EC) apoptosis and ONFH.
Nicholas Catanzaro et al.
Virus research, 276, 197820-197820 (2019-11-20)
Replication of most RNA viruses is closely associated with the endoplasmic reticulum (ER) within permissive cells. As such, viruses often induce tremendous amounts of stress on cells during viral replication. To cope with the stress, cells initiate the unfolded protein
Qun Huang et al.
Molecular and cellular biochemistry, 431(1-2), 67-74 (2017-03-03)
Studies have demonstrated that the high-mobility group 1B protein (HMGB1) could regulate endothelial progenitor cell (EPC) homing, but the effect of HMGB1 on EPC apoptosis and associated mechanisms are still unclear. The aim of this study was to investigate the
Excessive fluoride exposure induces thymocyte apoptosis and impairs cell division: Roles of the PERK and IRE1 pathways.
Wei Wei et al.
Toxicology letters, 328, 35-44 (2020-04-27)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service