Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU012661

Sigma-Aldrich

MISSION® esiRNA

targeting human PEBP1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€192.00
50 μG
€341.00

€192.00

Please contact Customer Service for Availability
All Photos(1)

Select a Size

Change View
20 μG
€192.00
50 μG
€341.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€192.00

Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATAGACCCACCAGCATTTCGTGGGATGGTCTTGATTCAGGGAAGCTCTACACCTTGGTCCTGACAGACCCGGATGCTCCCAGCAGGAAGGATCCCAAATACAGAGAATGGCATCATTTCCTGGTGGTCAACATGAAGGGCAATGACATCAGCAGTGGCACAGTCCTCTCCGATTATGTGGGCTCGGGGCCTCCCAAGGGCACAGGCCTCCACCGCTATGTCTGGCTGGTTTACGAGCAGGACAGGCCGCTAAAGTGTGACGAGCCCATCCTCAGCAACCGATCTGGAGACCACCGTGGCAAATTCAAGGTGGCGTCCTTCCGTAAAAAGTATGAGCTCAGGGCCCCGGTGGCTGGCACGTGTTACCAGGCCGAGTGGGATGACTATGTGCCCAAACTGTACGAGCAGCTGTCTGGGAAGTAGGGGGTTAGCTTGGGGACCTGAACTGTCCTGGAGGCCCCAAGCCATGTTCCCCAGTTCAGTGTTGCATGTATAATAGATTTCTCCTCTTCCTGCCC

Ensembl | human accession no.

ENSG00000089220

NCBI accession no.

NM_002567

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PEBP1(5037) , PEBP1(5037)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
QCS
DOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zixuan Gong et al.
Cancer management and research, 12, 9327-9338 (2020-10-17)
Much evidence unveils the significance of long non-coding RNAs (lncRNAs) in diverse cancers. This study was designed to clarify the function and mechanism of lncRNA GATA6 antisense RNA 1 (GATA6-AS1) in the progression of non-small cell lung cancer (NSCLC). GATA6-AS1
Yun Wang et al.
Oncology reports, 34(4), 2106-2114 (2015-08-05)
The Raf kinase inhibitor protein (RKIP) is a novel metastasis suppressor. RKIP was previously found to have low expression in a colorectal cancer (CRC) patient cohort by immunohistochemistry. However, the role of RKIP in CRC remains undetermined. In the present
Quanfang Huang et al.
Journal of cellular biochemistry, 120(4), 6168-6177 (2018-10-12)
The purpose of this study was to investigate the effect of Raf kinase inhibitor protein (RKIP) on the growth, apoptosis, invasion, and metastasis of human hepatic stellate cell line (LX-2). A recombinant plasmid (pcDNA3.1-RKIP) or RKIP-targeting small interfering RNA (siRNA)
Andrey Kazakov et al.
Basic research in cardiology, 113(6), 42-42 (2018-09-08)
Fibrosis is a hallmark of maladaptive cardiac remodelling. Here we report that genome-wide quantitative trait locus (QTL) analyses in recombinant inbred mouse lines of C57BL/6 J and DBA2/J strains identified Raf Kinase Inhibitor Protein (RKIP) as genetic marker of fibrosis progression.
Hae Sook Noh et al.
Autophagy, 12(11), 2183-2196 (2016-11-02)
Autophagy plays a critical role in maintaining cell homeostasis in response to various stressors through protein conjugation and activation of lysosome-dependent degradation. MAP1LC3B/LC3B (microtubule- associated protein 1 light chain 3 β) is conjugated with phosphatidylethanolamine (PE) in the membranes and
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service