Skip to Content
Merck
All Photos(1)

Key Documents

EHU122691

Sigma-Aldrich

MISSION® esiRNA

targeting human SMPD1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGACTCTCGGGTTCTCTGGGCTCCGGCAGAGGCTCACCCTCTTTCTCCCCAAGGCCATCCTGCCAGGTTACATCGCATAGTGCCCCGGCTCCGAGATGTCTTTGGGTGGGGGAACCTCACCTGCCCAATCTGCAAAGGTCTATTCACCGCCATCAACCTCGGGCTGAAGAAGGAACCCAATGTGGCTCGCGTGGGCTCCGTGGCCATCAAGCTGTGCAATCTGCTGAAGATAGCACCACCTGCCGTGTGCCAATCCATTGTCCACCTCTTTGAGGATGACATGGTGGAGGTGTGGAGACGCTCAGTGCTGAGCCCATCTGAGGCCTGTGGCCTGCTCCTGGGCTCCACCTGTGGGCACTGGGACATTTTCTCATCTTGGAACATCTCTTTGCCTACTGTGCCGAAGCCGCCCCCCAAACCCCCTAGCCCCCCAGCCCCAGGTGCCCCTGTCAGCCGCATCCTCTTCCTCACTGACCTGC

Ensembl | human accession no.

ENSG00000166311

NCBI accession no.

NM_000543

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMPD1(6609) , SMPD1(6609)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Vinay Shivanna et al.
Virology, 483, 218-228 (2015-05-20)
Our recent results demonstrated that bile acids facilitate virus escape from the endosomes into the cytoplasm for successful replication of porcine enteric calicivirus (PEC). We report a novel finding that bile acids can be substituted by cold treatment for endosomal
Kecheng Zhou et al.
The American journal of pathology, 190(10), 2018-2028 (2020-07-18)
Studies of lysosome associated protein transmembrane 4B (LAPTM4B) have mainly focused on the 35-kDa isoform and its association with poor prognosis in cancers. Here, by employing a novel monoclonal antibody, the authors found that the 24-kDa LAPTM4B isoform predominated in
A Bai et al.
Cell death & disease, 6, e1828-e1828 (2015-07-24)
Acid sphingomyelinase (ASM), a lipid hydrolase enzyme, has the potential to modulate various cellular activation responses via the generation of ceramide and by interaction with cellular receptors. We have hypothesized that ASM modulates CD4(+) T-cell receptor activation and impacts immune

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service