Skip to Content
Merck
All Photos(1)

Key Documents

EHU077471

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wanmu Xie et al.
Journal of thrombosis and thrombolysis, 50(1), 98-111 (2020-05-03)
Venous thromboembolism (VTE) carries a high risk of morbidity and mortality. Understanding the mechanisms of venous thrombus formation and resolution is critical for improving VTE management. AKT2 kinase is essential for platelet activation and arterial thrombosis. In this study, we
Mohammad Imran Khan et al.
Molecular cancer therapeutics, 18(2), 356-363 (2018-11-18)
Hyperactivated AKT kinase due to loss of its negative regulator PTEN influences many aspects of cancer biology, including chromatin. AKT primarily regulates acetyl-CoA production and phosphorylates many histone-modulating enzymes, resulting in their activation or inhibition. Therefore, understanding the therapeutic impact
Yong Cui et al.
OncoTargets and therapy, 8, 1681-1690 (2015-07-18)
The AKT2 kinase (protein kinase Bβ) is overexpressed in high-grade gliomas. Upregulation of the AKT2 gene has been previously observed in glioblastoma patients suffering from chemotherapy failure and tumor progress. In this study, we aimed to evaluate the effect of
Yang Sun et al.
PloS one, 10(4), e0119783-e0119783 (2015-04-10)
Aberrant microRNA (miRNA) expression is associated with tumor development. This study aimed to elucidate the role of miR-615-5p in the development of pancreatic ductal adenocarcinoma (PDAC). Locked nucleic acid in situ hybridization (LNA-ISH) was performed to compare miR-615-5p expression in
Irene Bertolini et al.
Developmental cell, 55(2), 163-177 (2020-08-12)
The crosstalk between tumor cells and the adjacent normal epithelium contributes to cancer progression, but its regulators have remained elusive. Here, we show that breast cancer cells maintained in hypoxia release small extracellular vesicles (sEVs) that activate mitochondrial dynamics, stimulate

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service