Skip to Content
Merck
All Photos(1)

Key Documents

EHU097521

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCAGAAGCGAAGGTCACAAAAGATAACAGGAAGTCCAACCTTAGTAAAAAATATACCTACCAGTTTAGGCTATGGAGCAGCTCTTAATGCCAGTTTGCAGGCTGCCTTGGCAGAGAGCAGTTTACCTTTGCTAAGTAATCCTGGACTGATAAATAATGCATCCAGTGGCCTACTGCAGGCCGTCCACGAAGACCTCAATGGTTCTCTGGATCACATTGACAGCAATGGAAACAGTAGTCCGGGCTGCTCACCTCAGCCGCACATACATTCAATCCACGTCAAGGAAGAGCCAGTGATTGCAGAGGATGAAGACTGCCCAATGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

W-X Wang et al.
European review for medical and pharmacological sciences, 23(15), 6467-6477 (2019-08-06)
Colorectal carcinoma (CRC) is a common malignant tumor of the digestive tract that occurs in the colon, and the incidence is the third in the gastrointestinal tumor. Recently, the dysregulated expression of microRNA-9 (miR-9) has been identified in many human
Yixiao Liu et al.
International journal of molecular sciences, 21(6) (2020-03-19)
Diabetes mellitus is a growing global health issue nearly across the world. Diabetic patients who are prone to develop diabetes-related complications often exhibit progressive neuropathy (painless and sensory loss). It is usual for small wounds to progress to ulceration, which

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service