Skip to Content
Merck
All Photos(1)

Key Documents

EHU015391

Sigma-Aldrich

MISSION® esiRNA

targeting human PARN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTTTTCCCGAAACCCTTCAATAGATCCTCACCAGATGTCAAATTTGTTTGTCAGAGCTCCAGCATTGACTTTCTAGCAAGCCAGGGATTTGATTTTAATAAAGTTTTTCGAAATGGAATTCCATATTTAAATCAGGAAGAAGAAAGACAGTTAAGAGAGCAGTATGATGAAAAACGTTCACAGGCGAATGGTGCAGGAGCTCTGTCCTATGTATCTCCTAACACTTCAAAATGTCCTGTCACGATTCCTGAGGATCAAAAGAAGTTTATTGACCAAGTGGTAGAGAAAATAGAGGATTTATTACAAAGTGAAGAAAACAAGAACTTGGATTTAGAGCCATGTACCGGGTTCCAAAGAAAACTAATTTATCAGACTTTGAGCTGGAAGTATCCGAAAGGCATTCATGTTGAGACTTTAGAAACTGAAAAGAAGGAGCGATATATAGTTATCAGCAAAGTAGATGAAGAAGAACGCAAAAGAAGAGAGCAGCAGAAACATGCCAAAGA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Blanca Nieto et al.
Nature communications, 11(1), 156-156 (2020-01-11)
Technical problems intrinsic to the purification of preribosome intermediates have limited our understanding of ribosome biosynthesis in humans. Addressing this issue is important given the implication of this biological process in human disease. Here we report a preribosome purification and
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service