Skip to Content
Merck
All Photos(1)

Documents

EMU061611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pdpn

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGGCTTGCCAGTAGTCACCCTGGTTGGAATCATAGTTGGCGTCTTGTTAGCCATTGGCTTCGTCGGAGGGATCTTCATTGTTGTTATGAAGAAGATTTCTGGAAGGTCTCGCCCTAAAGAGCTAAACAGAACAGGTTGTTCTCCCAACACATCTGAAAATAAGAGAGCTTCCAACTTGCCCTGTTCCCCATCCTCTTCCTGTGGAGGAAGATGACCCATGGCGTGCCCACCCACCCCACCCACAGCCATGGTGACCCCTCCGCTTGGCCAGCAGTACCAAAGGAAAGATACAGGACAAGCCACAGCCCCTCAAAGCATCTGCCTTTGGAAAACTAAATTTTTAACATAAATGTTATGATCGATGATTCAAAAGACAACATGCTTAGAAAATGGAGCAAAGCCAA

Ensembl | mouse accession no.

ENSMUSG00000028583

NCBI accession no.

NM_010329

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... PDPN(14726) , Pdpn(14726)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Frédéric Larrieu-Lahargue et al.
PloS one, 7(6), e39540-e39540 (2012-07-05)
Fibroblast Growth Factor receptor (FGFR) activity plays crucial roles in tumor growth and patient survival. However, FGF (Fibroblast Growth Factor) signaling as a target for cancer therapy has been under-investigated compared to other receptor tyrosine kinases. Here, we studied the
Yan Song et al.
Cellular and molecular neurobiology, 34(6), 839-849 (2014-05-14)
Podoplanin (PDPN) is a mucin-type transmembrane sialoglycoprotein expressed in multiple tissues in adult animals, including the brain, lungs, kidney, and lymphoid organs. Studies of this molecule have demonstrated its great importance in tumor metastasis, platelet aggregation, and lymphatic vessel formation.
René Hägerling et al.
The EMBO journal, 32(5), 629-644 (2013-01-10)
During mammalian development, a subpopulation of endothelial cells in the cardinal vein (CV) expresses lymphatic-specific genes and subsequently develops into the first lymphatic structures, collectively termed as lymph sacs. Budding, sprouting and ballooning of lymphatic endothelial cells (LECs) have been
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined
Yoshihiko Sawa et al.
PloS one, 9(5), e97165-e97165 (2014-05-20)
The toll-like receptor (TLR) has been suggested as a candidate cause for diabetic nephropathy. Recently, we have reported the TLR4 expression in diabetic mouse glomerular endothelium. The study here investigates the effects of the periodontal pathogen Porphyromonas gingivalis lipopolysaccharide (LPS)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service