Skip to Content
Merck
All Photos(1)

Key Documents

EMU024721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$335.00
50 μG
$584.00

$335.00

Estimated to ship on28 April 2025

All Photos(1)

Select a Size

Change View
20 μG
$335.00
50 μG
$584.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$335.00

Estimated to ship on28 April 2025

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGCTCTCTTCCAGTTCTCAGACACACTCACTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCCCAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGCTCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTTTGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCAACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTTGTCTCTCAGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGG

Ensembl | mouse accession no.

ENSMUSG00000022997

NCBI accession no.

NM_021279

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... WNT1(22408) , Wnt1(22408)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
UZU
AOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Megan M Weivoda et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 76-85 (2015-06-26)
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts
Nithidol Sakunrangsit et al.
Pharmacological research, 150, 104517-104517 (2019-11-07)
Fifty percent of advanced stage ER-positive breast cancer patients develop endocrine resistance. Aberrant activation of Wnt/β-catenin is associated with stem-like phenotypes and epithelial-mesenchymal transition (EMT) process which confers resistance to endocrine therapy. Cancer stem-like cells (CSLCs) can be a vital
Han Yan et al.
Molecular carcinogenesis, 53(12), 960-969 (2013-07-19)
The epithelial-mesenchymal transition (EMT) and acquisition of cancer stem cells (CSCs)-like properties are essential steps in the metastasis and postsurgical recurrence of hepatocellular carcinomas (HCCs). The molecular mechanisms involved, however, remain obscure. As determined by an miRNA microarray analysis, there
Jian Cao et al.
Prostaglandins & other lipid mediators, 116-117, 76-86 (2015-02-14)
Myocardial infarction (MI) is complicated by ventricular fibrosis and associated diastolic and systolic failure. Emerging studies implicate Wnt1 signaling in the formation of new blood vessels. Epoxyeicosatrienoic acids (EETs)-mediated up-regulation of heme oxygenase-1 (HO-1) protects against the detrimental consequences of

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service