Skip to Content
Merck
All Photos(1)

Key Documents

EMU005041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fbxw7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGGAATGCTGAAACTGGAGAGTGTATACATACTTTATATGGGCACACTTCTACTGTACGGTGTATGCATCTCCATGAAAAAAGGGTTGTAAGCGGTTCTCGAGATGCCACTCTCAGGGTTTGGGATATTGAGACCGGCCAGTGTTTACACGTCCTGATGGGTCACGTAGCAGCGGTCCGCTGCGTTCAGTATGATGGCAGGAGGGTTGTTAGTGGAGCTTATGATTTTATGGTGAAGGTGTGGGATCCAGAGACTGAGACCTGTCTACACACGTTACAGGGACACACTAATAGAGTCTATTCATTACAGTTTGATGGCATCCATGTGGTGAGTGGATCTCTTGATACATCAATCCGAGTCTGGGATGTGGAGACAGGGAATTGTATTCACACGCTAACAGGACACC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kangsheng Tu et al.
Molecular cancer, 13, 110-110 (2014-06-03)
The E3 ubiquitin ligase Fbxw7 functions as a general tumor suppressor by targeting several well-known oncoproteins for ubiquitination and proteasomal degradation. However, the clinical significance of Fbxw7 and the mechanisms involved in the anti-cancer effect of Fbxw7 in HCC are
Xiaoying Zhou et al.
Journal of experimental & clinical cancer research : CR, 34, 28-28 (2015-04-19)
Increasing evidence showed that miRNAs serve as modulators of human cancer, either as oncogene or tumor suppressors. Cisplatin resistance is the most common cause of chemotherapy failure in gastric cancer (GC). However, the roles of miRNAs in cisplatin resistance of
Junghui Koo et al.
The Journal of biological chemistry, 290(22), 14120-14129 (2015-04-22)
Rictor, an essential component of mTOR complex 2 (mTORC2), plays a pivotal role in regulating mTOR signaling and other biological functions. Posttranslational regulation of rictor (e.g. via degradation) and its underlying mechanism are largely undefined and thus are the focus

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service