Select a Size
$397.00
Estimated to ship on29 April 2025
Select a Size
About This Item
$397.00
Estimated to ship on29 April 2025
form
lyophilized
lyophilized powder
esiRNA cDNA target sequence
AAAACACAAACATTCAAAGCTTAGGGATAGGTCCTTGGGTCAAAAGTTGTAAATAAATGTGAAACATCTTCTCATGCAATTATTTTATTATCCAACACACTAATCTTTTGATACTTTATATAATTCCCTTTCTTCATATACTGCATCCAGTACTAGAACCATCATTATTATGTATCATTTTGAAAGAATACCTGATGAGATGAAGGATGAGAACAAATGACAGAGATGAGTCTCCAAGTAAAGGGGGCCTCACATCAATAATTAGGAAACTTAGATATAAGTCGCCCTTTTCTGAAAATTCTACCCCAAGTCATTTA
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... ERBB4(2066)
Related Categories
1 of 4
This Item | EHU233041 | EHU903371 | EHU900071 |
|---|---|---|---|
| Gene Information human ... ERBB4(2066) | Gene Information human ... ERBB4(2066) | Gene Information human ... EPHA8(2046) | Gene Information human ... NR2F6(2063) |
| form lyophilized, lyophilized powder | form lyophilized, lyophilized powder | form lyophilized, lyophilized powder | form lyophilized, lyophilized powder |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
| shipped in ambient | shipped in ambient | shipped in ambient | shipped in ambient |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
11 - Combustible Solids
WGK
WGK 1
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.
If you need assistance, please contact Customer Support.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
