Skip to Content
Merck
All Photos(1)

Key Documents

EHU138091

Sigma-Aldrich

MISSION® esiRNA

targeting human FUNDC1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$335.00
50 μG
$584.00

$335.00


Estimated to ship on27 April 2025



Select a Size

Change View
20 μG
$335.00
50 μG
$584.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$335.00


Estimated to ship on27 April 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGAGTGTTTGGCCACAGTTCGGGACCTATGGTAGAAAAATACTCAGTAGCTACCCAGATTGTAATGGGTGGCGTTACTGGCTGGTGTGCAGGATTTCTGTTCCAGAAAGTTGGAAAACTTGCAGCAACTGCAGTAGGTGGTGGCTTTCTTCTTCTTCAGATTGCTAGTCATAGTGGCTATGTGCAGATTGACTGGAAGAGAGTTGAAAAAGATGTAAATAAAGCAAAAAGACAGATTAAGAAACGAGCGAACAAAGCAGCACCTGAAATCAACAATTTAATTGAAGAAGCAACAGAATTTATCAAGCAGAACATTGTGATATCCAGTGGATTTGTGGGAGGCTTTTTGCTCGGACTTGCATCTTAAGGACATGAATATTCTCCCATAACGGATTCAACTATGAGAAGAGAAGTGGCAGCAATAAGGCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Hui et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(5), 596-606 (2018-10-05)
The purpose of our study was to investigate an underlying mechanism that hydrogen peroxide-induced mitophagy contributed to laryngeal cancer cells survivals under oxidative stress condition. Tumor tissue and serum samples were collected from patients with laryngeal cancer. The Hep2 cell
Hao Zhou et al.
Basic research in cardiology, 113(4), 23-23 (2018-05-11)
Mitochondrial fission and mitophagy are considered key processes involved in the pathogenesis of cardiac microvascular ischemia reperfusion (IR) injury although the upstream regulatory mechanism for fission and mitophagy still remains unclear. Herein, we reported that NR4A1 was significantly upregulated following

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service