Skip to Content
Merck
All Photos(1)

Documents

EHU108101

Sigma-Aldrich

MISSION® esiRNA

targeting human CKS2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGCTCTCGTTTCATTTTCTGCAGCGCGCCAGCAGGATGGCCCACAAGCAGATCTACTACTCGGACAAGTACTTCGACGAACACTACGAGTACCGGCATGTTATGTTACCCAGAGAACTTTCCAAACAAGTACCTAAAACTCATCTGATGTCTGAAGAGGAGTGGAGGAGACTTGGTGTCCAACAGAGTCTAGGCTGGGTTCATTACATGATTCATGAGCCAGAACCACATATTCTTCTCTTTAGACGACCTCTTCCAAAAGATCAACAAAAATGAAGTTTATCTGGGGATCGTCAAATCTTTTTCAAATTTAATGTATATGTGTATATAAGGTAGTATTCAGTGAATACTTGAGAAATGTACAAATCTTTCATCCATACCTGTGCATGAGCTGTATTCTTCACAGCAACAGAGCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jun Li et al.
Cancer communications (London, England), 38(1), 13-13 (2018-05-17)
Pancreatic duct adenocarcinoma (PDAC) remains a major health problem because conventional cancer treatments are relatively ineffective against it. Microarray studies have linked many genes to pancreatic cancer, but the available data have not been extensively mined for potential insights into
Min-Hao Yu et al.
American journal of cancer research, 5(9), 2708-2718 (2015-11-27)
Cyclin-dependent kinases regulatory subunit 2 (CKS2) is a cyclin-dependent kinase-interacting protein, which is essential for cell cycle regulation. Elevated expression of CKS2 has been demonstrated in multiple types of human malignancies. However, the clinical significance, oncogenic functions and related mechanisms
Yupeng Deng et al.
Oncology letters, 18(3), 2845-2852 (2019-08-28)
Cyclin-dependent kinase subunit (CKS) 2 is a member of the CKS family, which plays an important role in the regulation of meiosis and mitosis. Overexpression of CKS2 has been reported in several types of tumors. However, few studies have investigated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service