Skip to Content
Merck
All Photos(1)

Key Documents

EHU092251

Sigma-Aldrich

MISSION® esiRNA

targeting human HNF4G

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGTCTCGCCAGATCTCAGTCTCAAGCCCTGGGTCAAGCACTGACATAAACGTTAAGAAAATTGCAAGTATTGGTGATGTCTGTGAATCTATGAAACAGCAGCTCTTAGTCTTGGTGGAATGGGCTAAATATATTCCTGCCTTCTGTGAATTACCATTGGATGATCAGGTGGCACTGTTGAGAGCTCACGCAGGGGAGCACTTACTGCTTGGAGCTACAAAGAGATCCATGATGTATAAAGATATTTTGCTTTTGGGAAACAACTATGTTATTCACCGCAACAGCTGTGAAGTTGAGATTAGCCGTGTGGCCAATCGTGTTCTAGATGAGCTGGTTAGACCATTTCAAGAAATCCAGATTGATGACAATGAGTATGCTTGTTTAAAGGCAATTGTATTTTTTGATCCAGATGCAAAAGGGCTAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Huaibin Sun et al.
Disease markers, 2015, 879254-879254 (2015-04-17)
miR-34a is a member of the miR-34 family and acts as a tumor suppressor in bladder cancer. This study explored the regulative role of miR-34a on an orphan nuclear receptor HNF4G, which has a well-confirmed role in bladder tumor growth
Daliang Kong et al.
Journal of cellular biochemistry, 119(1), 1050-1061 (2017-07-09)
Osteosarcoma is a rare malignant bone tumor with high degree of malignancy. HULC (highly upregulated in liver cancer), a long noncoding RNA (lncRNA) was involved in hepatocellular carcinoma development and progression, but its underlying mechanism in osteosarcoma is unknown. The

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service