Skip to Content
Merck
All Photos(1)

Documents

EHU043071

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACATCCGAGCTTTCGACTCCCGTTTCTCCAATATCAAAACATTGGATGATTTGTTTCCTCTGAGAAGTATGGTCTTTATGCTGGGAACTCCCTATTATGGCTGCACTGGAGAAGTTCAGGATTCAGGTGATGTGATTACAGAAGGTAGGATTCGTGTGATTTTCAGCATTCCATGTGAACCCAATCTTGATGCTTTAATACAGAACCAGCATAAATATTCTATAAAGTACAACCCAGGATATGTGTTGGCCAGTCGCCTTGGAGTGAGTGGATACCTTGTTTCAAGGTTTACAGGAAGTATTTTTATTGGAAGAGGATCTAGGAGAAACCCTCATGGAGACCATAAAGCAAATGTGGGTTTAAATCTCAAATTCAACAAGAAAAATGAGGAGGTACCTGGATATACTAAGAAAGTTGGAAGTGAATGGATGTATTCATCTGCAGCAGAACAACTTCTGGCA

Ensembl | human accession no.

ENSG00000114127

NCBI accession no.

NM_019001

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... XRN1(54464) , XRN1(54464)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Maïté Courel et al.
eLife, 8 (2019-12-20)
mRNA translation and decay appear often intimately linked although the rules of this interplay are poorly understood. In this study, we combined our recent P-body transcriptome with transcriptomes obtained following silencing of broadly acting mRNA decay and repression factors, and
Joséphine Zangari et al.
Nucleic acids research, 45(7), 4131-4141 (2016-12-21)
Extracellular vesicles (EVs) have been shown to play an important role in intercellular communication as carriers of DNA, RNA and proteins. While the intercellular transfer of miRNA through EVs has been extensively studied, the stability of extracellular miRNA (ex-miRNA) once
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Alicia J Angelbello et al.
Cell chemical biology, 28(1), 34-45 (2020-11-07)
Many diseases are caused by toxic RNA repeats. Herein, we designed a lead small molecule that binds the structure of the r(CUG) repeat expansion [r(CUG)exp] that causes myotonic dystrophy type 1 (DM1) and Fuchs endothelial corneal dystrophy (FECD) and rescues
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service