Skip to Content
Merck
All Photos(1)

Key Documents

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)
All Photos(1)

Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00

Usually ships in 1 week. (Orders outside of US and Europe, please allow an additional 1-2 weeks for delivery)

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Ensembl | human accession no.

ENSG00000168036

NCBI accession no.

NM_001098209

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTNNB1(1499) , CTNNB1(1499)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
UBV
RYU
MWU
STU
ZRU

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Xuejie Jiang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2417-2429 (2018-02-22)
Purpose: Wnt/β-catenin signaling is required for leukemic stem cell function. FLT3 mutations are frequently observed in acute myeloid leukemia (AML). Anomalous FLT3 signaling increases β-catenin nuclear localization and transcriptional activity. FLT3 tyrosine kinase inhibitors (TKI) are used clinically to treat
Bryan E Essien et al.
Cancer research, 76(23), 6877-6887 (2016-10-21)
In colorectal cancer, APC-mediated induction of unregulated cell growth involves posttranslational mechanisms that prevent proteasomal degradation of proto-oncogene β-catenin (CTNNB1) and its eventual translocation to the nucleus. However, about 10% of colorectal tumors also exhibit increased CTNNB1 mRNA. Here, we
Pradip De et al.
Oncotarget, 8(2), 3072-3103 (2016-12-03)
The acquisition of integrin-directed metastasis-associated (ID-MA) phenotypes by Triple-Negative Breast Cancer (TNBC) cells is caused by an upregulation of the Wnt-beta-catenin pathway (WP). We reported that WP is one of the salient genetic features of TNBC. RAC-GTPases, small G-proteins which
Rob M Ewing et al.
Journal of proteome research, 17(6), 2216-2225 (2018-05-12)
The dysregulation of Wnt signaling is a frequent occurrence in many different cancers. Oncogenic mutations of CTNNB1/β-catenin, the key nuclear effector of canonical Wnt signaling, lead to the accumulation and stabilization of β-catenin protein with diverse effects in cancer cells.
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service