Skip to Content
Merck
All Photos(1)

Key Documents

EHU130881

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao-Guang Li et al.
EMBO reports, 20(6) (2019-05-16)
Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of
Wudian Xiao et al.
Microbial pathogenesis, 144, 104175-104175 (2020-04-01)
Trichophyton mentagrophytes (T. mentagrophytes) is the main cause of rabbit dermatophytosis. As the main pathogen-associated molecular pattern of T. mentagrophytes, the role of β-glucan in the pathogenesis of rabbit dermatophytosis remains elusive. Keratinocytes (KC) are the main cellular component and the first
Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Xilong Wang et al.
International journal of clinical and experimental pathology, 8(5), 5017-5025 (2015-07-21)
MicroRNAs (miRNAs) have emerged as important regulators that potentially play critical roles in cancer cell biological processes. Previous studies have shown that miR-204 plays an important role in various human cancers. However, the underlying mechanisms of this microRNA in breast
Yuanyuan Zhou et al.
Journal of physiology and biochemistry, 73(2), 259-266 (2017-01-31)
The primary features of Alzheimer's disease (AD) are extracellular amyloid plaques consisting mainly of deposits of amyloid β (Aβ) peptides and intracellular neurofibrillary tangles (NFTs). Sets of evidence suggest that interleukin-5 (IL-5) is involved in the pathogenesis of AD. Herein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service