Skip to Content
Merck
All Photos(1)

Key Documents

EHU127461

Sigma-Aldrich

MISSION® esiRNA

targeting human TPSD1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AACCGGACATCAAGGATCTGGCCGCCCTCAGGGTGCAACTGCGGGAGCAGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCACCCACAGTTCTACATCATCCAGACCGGGGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCCGTGAACATCTCCAGCCACATCCACACGGTCACGCTGCCCCCTGCCTCGGAGACCTTCCCCCCGGGGATGCCGTGCTGGGTCACTGGCTGGGGCGACGTGGACAATAATGTGCACCTGCCGCCGCCATACCCGCTGAAGGAGGTGGAAGTCCCCGTAGTGGAAAACCACCTTTGCAACGCGGAATATCACACCGGCCTCCATACGGGCCACAGCTTTCAAATCGTCCGCGATGACATGCTGTGTGCGGGGAGCGAAAATCACGACTCCTGCCAGGGTGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTAACTGCAGGCGGGCGTGGTCAGCTGGGAGGAGAGCTGTGCCCAGCCCAACCGGCCTGGCATCTACACCCGTGTCACCTACTACTTGGACTGGATCCACCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gyl Eanes Barros Silva et al.
Clinics (Sao Paulo, Brazil), 67(7), 697-703 (2012-08-16)
The objectives of our study were as follows: 1) to analyze the prognostic value of macrophage infiltration in primary IgA nephropathy (IgAN) and 2) to study the relationship between macrophages and other factors associated with the development of renal fibrosis
Marianne Gamper et al.
The Journal of urology, 193(6), 1994-2000 (2015-01-18)
ESSIC identifies mast cell infiltrates of detrusor muscle as a diagnostic criterion for bladder pain syndrome/interstitial cystitis. However, an increased mast cell count is also characteristic of overactive bladder syndrome. The lack of uniformity in mast cell detection methods hampers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service