Skip to Content
Merck
All Photos(1)

Key Documents

EHU119091

Sigma-Aldrich

MISSION® esiRNA

targeting human PERP

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATAACTGGGCCTACGGCTTTGGGTGGGCAGCCACGATTATCCTGATTGGCTGTGCCTTCTTCTTCTGCTGCCTCCCCAACTACGAAGATGACCTTCTGGGCAATGCCAAGCCCAGGTACTTCTACACATCTGCCTAACTTGGGAATGAATGTGGGAGAAAATCGCTGCTGCTGAGATGGACTCCAGAAGAAGAAACTGTTTCTCCAGGCGACTTTGAACCCATTTTTTGGCAGTGTTCATATTATTAAACTAGTCAAAAATGCTAAAATAATTTGGGAGAAAATATTTTTTAAGTAGTGTTATAGTTTCATGTTTATCTTTTATTATGTTTTGTGAAGTTGTGTCTTTTCACTAATTACCTATACTATGCCAATATTTCCTTATATCTATCCATAACATTTATACTACATTTGTAAGAGAATATGCACGTGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu Zhang et al.
Journal of cellular physiology, 234(7), 11330-11347 (2018-11-28)
Salmonella Enteritidis (SE) can be transmitted to eggs through cecum or the ovary from infected layers and causes food poisoning in humans. The mechanism of cecal transmission has been extensively studied. However, the mechanism and route of transovarian transmission of
Yu Zhang et al.
PeerJ, 7, e7663-e7663 (2019-10-01)
The zoonotic pathogen Salmonella not only reduces the production performance in ducks, but also poses a serious threat to human health through eggs and pollutes water bodies through feces. SipC, an effector protein of type III secretion systems (T3SS) in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service