Skip to Content
Merck
All Photos(1)

Key Documents

EHU109741

Sigma-Aldrich

MISSION® esiRNA

targeting human WDR5

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAAGTCCCTTTGCTCCTGCCCGCGAGAGACTGTCGGGAAGTTGACCCGGATTGGCAAGAAACAGGGTGTCTTGGAGGTGGTCCCCCAGATCTGCGCCTGGGGGTCAGGACAGGGCCTGATTTGAGCCTCCTCTCTGAAGATGATTTGGCCGAGCGGAAGGTGTGGACCACCGGAAAGTTCTTAAAAGTTGCTGGTGACATTTCTTGC

Ensembl | human accession no.

ENSG00000196363

NCBI accession no.

NM_017588

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... WDR5(11091) , WDR5(11091)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

WGK

WGK 1

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Biao Ding et al.
Biology of reproduction, 96(4), 758-771 (2017-04-06)
WD repeat-containing protein 5 (WDR5), a member of conserved WD40 protein family, is an essential component of the mixed lineage leukemia (MLL) complexes, which are crucial for numerous key biological processes including methylation of histone H3 lysine 4 (H3K4), self-renewal
Xin Tan et al.
Cell death & disease, 8(3), e2686-e2686 (2017-03-17)
Colorectal cancer (CRC) is the third most common cause of cancer deaths, and has a high rate of liver and lung metastasis. Unfortunately, distant metastasis is the main barrier for advanced CRC therapy and leads to a very low survival
Bin Dai et al.
Cancer management and research, 12, 3223-3235 (2020-05-23)
Glioma is one of the important diseases that threaten human survival in today's society. WD repeat domain 5 (WDR5) belongs to the components of the lysine methyltransferase complex. WDR5 is involved in gene transcription regulation, cell senescence, cancer and other
Qianghua Zhou et al.
Theranostics, 11(10), 4809-4824 (2021-03-24)
Purpose: Advanced prostate cancer (PCa) has limited treatment regimens and shows low response to chemotherapy and immunotherapy, leading to poor prognosis. Histone modification is a vital mechanism of gene expression and a promising therapy target. In this study, we characterized
Di Huang et al.
OncoTargets and therapy, 13, 10525-10534 (2020-10-30)
The WD40 protein family member WD repeat domain 5 (WDR5) plays significant roles in the tumorigenesis and development of multiple organ tumours. However, the correlation between WDR5 expression and oesophageal squamous cell carcinoma (ESCC) has not been elucidated. WDR5 mRNA
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service