Skip to Content
Merck
All Photos(1)

Documents

EHU094261

Sigma-Aldrich

MISSION® esiRNA

targeting human DUOX1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAAGGATGGCAATGGCTACCTGTCCTTCCGAGAGTTCCTGGACATCCTGGTGGTCTTCATGAAAGGCTCTCCTGAGGAAAAGTCTCGCCTTATGTTCCGCATGTACGACTTTGATGGGAATGGCCTCATTTCCAAGGATGAGTTCATCAGGATGCTGAGATCCTTCATCGAGATCTCCAACAACTGCCTGTCCAAGGCCCAGCTGGCTGAGGTGGTGGAGTCCATGTTCCGGGAGTCGGGATTCCAGGACAAGGAGGAACTGACATGGGAAGATTTTCACTTCATGCTGCGGGACCACAATAGCGAGCTCCGCTTCACGCAGCTCTGTGTCAAAGGGGTGGAGGTGCCTGAAGTCATCAAGGACCTCTGCCGGCGAGCCTCCTACATCAGCCAGGATATGATCTGTCCCTCTCCCAGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sergio Candel et al.
PLoS biology, 12(5), e1001855-e1001855 (2014-05-08)
TNFα overexpression has been associated with several chronic inflammatory diseases, including psoriasis, lichen planus, rheumatoid arthritis, and inflammatory bowel disease. Paradoxically, numerous studies have reported new-onset psoriasis and lichen planus following TNFα antagonist therapy. Here, we show that genetic inhibition
Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service