Skip to Content
Merck
All Photos(1)

Key Documents

EHU065641

Sigma-Aldrich

MISSION® esiRNA

targeting human CCDC6

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
€197.00
50 μG
€349.00

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
€197.00
50 μG
€349.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

€197.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAGCAAGAGAACAAGGTGCTGAAGATAGAGCTGGAGACCTACAAACTGAAGTGCAAGGCACTGCAGGAGGAGAACCGCGACCTGCGCAAAGCCAGCGTGACCATCCAAGCCAGGGCTGAGCAGGAAGAAGAATTCATTAGTAACACTTTATTCAAGAAAATTCAGGCTTTGCAGAAGGAGAAAGAAACCCTTGCTGTAAATTATGAGAAAGAAGAAGAATTCCTCACTAATGAGCTCTCCAGAAAATTGATGCAGTTGCAGCATGAGAAAGCCGAACTAGAACAGCATCTTGAACAAGAGCAGGAATTTCAGGTCAACAAACTGATGAAGAAAATTAAAAAACTGGAGAATGACACCATTTCTAAGCAACTTACATTAGAACAGTTGAGACGGGAGAAGATTGACCTTGAAAATACATTGGAACAAGAACAAGAAGCACTAGTTAATCGCCTCTGGAAAAGGAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Francesco Morra et al.
Lung cancer (Amsterdam, Netherlands), 135, 56-65 (2019-08-27)
CCDC6 (coiled-coil domain containing 6) is a player of the HR response to DNA damage and has been predicted to interact with BAP1, another HR-DNA repair gene highly mutated in Malignant Pleural Mesothelioma (MPM), an aggressive cancer with poor prognosis.
Francesco Morra et al.
Oncotarget, 8(19), 31815-31829 (2017-04-19)
Reduced levels of the tumor suppressor protein CCDC6 sensitize cancer cells to the treatment with PARP-inhibitors. The turnover of CCDC6 protein is regulated by the de-ubiquitinase USP7, which also controls the androgen receptor (AR) stability. Here, we correlated the expression
Francesco Morra et al.
Oncotarget, 6(14), 12697-12709 (2015-04-18)
CCDC6 gene product is a pro-apoptotic protein substrate of ATM, whose loss or inactivation enhances tumour progression. In primary tumours, the impaired function of CCDC6 protein has been ascribed to CCDC6 rearrangements and to somatic mutations in several neoplasia. Recently

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service